3dsnp v2 for developers

3DSNP v2 extends the API functions of the previous version. The domain was changed and more importantly, SV data and some new tables were included. Now data can be accessed by three means: SNP ids, SV ids or Chromatin position.

We recommend using positions to search for variants which will display both SNPs and SVs in the target region.

We marked new features with *

Note: The original API are always open.

Overview

URL

https://omic.tech/3dsnpv2/api.do

Format supported

JSON/XML

HTTP request method

GET/POST

Login required

Data access restrictions

Frequency limit: No

Request

Request parameters

	Required	Type	Information
id^*/position	true	string	Represents the SNP/SV ID or genomic position, at least one of them is required, multiple SNP IDs or positions should separated by comma ‘,’. Dash symbol ‘-‘ The format of parameter ‘position’ should be ‘1000000-1000100’. SV IDs could be found in HGSVC v2.
chrom	false	string	Represents the chromosome of queried position and is required when parameter ‘position’ is used. When there are more than one positions, the corresponding chromosomes should also be separated by ‘,’.
type	true	string	Data type for searching, multiple types should be separated by comma ‘,’. Available types are listed below.
format	true	string	Represents data types returns. Json and XML formats are supported.

Request data type

DataType	Description
basic	Basic information of SNP, including sequential facts and phenotype from 1000G project.
chromhmm	Chromatin state information generated by the core 15-state ChromHMM models trained across a variety of cell types.
motif	Transcription factor binding motifs altered by SNP.
tfbs	Transcription factor binding sites in a variety of cell types.
eqtl	Expression quantitative trait loci (eQTL).
3dgene	Genes that interact the query SNP through chromatin loops.
3dsnp	SNPs that interact the query SNP through chromatin loops. Not available for the query of position.
phylop	PhyloP scores of genomic region surrounding the query SNP.
ccre^*	The status of open chromatin for over 750,000 candidate cis-regulatory elements (cCREs) in 54 distinct cell types.
genetics^*	Integrated haplotype scores (iHS) and Fixation index (Fst) for five continental population obtained from 1000 Genomes Phase 3 (final phase)
clinvar^*	ClinVar aggregates information about genomic variation and its relationship to human health.

Response

Response parameters

	Type	DataType	Description
id	string	basic	SNP ID
chr	string	basic	Chromosome name
position	string	basic	Location of the query
MAF	string	basic	Minor allele frequency
Ref	string	basic	Reference Allele
Alt	string	basic	Alternative Allele
EAS	string	basic	Allele frequency in the EAS populations
AMR	string	basic	Allele frequency in the AMR populations
AFR	string	basic	Allele frequency in the AFR populations
EUR	string	basic	Allele frequency in the EUR populations
SAS	string	basic	Allele frequency in the SAS populations
linearClosestGene	string	basic	Linear cloest genes
data_gene	JsonArray	basic	listed below in JsonArray Parameters
chromhmm	string	chromhmm	Chromatin state from ChromHMM core 15-state model
data_chromhmm	JsonArray	chromhmm	listed below in JsonArray Parameters
motif	string	motif	Sequence motif altered by the query SNP
data_motif	JsonArray	motif	listed below in JsonArray Parameters
tfbs	string	tfbs	Transcription factor binding sites the query locates
data_tfbs	JsonArray	tfbs	listed below in JsonArray Parameters
eqtl	string	eqtl	Expression quantitative trait loci
data_eqtl	JsonArray	eqtl	listed below in JsonArray Parameters
data_loop_gene	JsonArray	3dgene	listed below in JsonArray Parameters
data_loop_snp	JsonArray	3dsnp	listed below in JsonArray Parameters
physcores	string	physcores	PhyloP scores of the query SNP and its +/-10 bp adjacent regions
ccre.position^*	string	ccre	The corresponding peak position of cCREs
mapping^*	string	ccre	Mapping rate of cCREs
Fol/Acn/Skm1/…/Swn_2^*	string	ccre	cCREs in 54 distinct cell types
Fst_EUR^*	string	genetics	Fixation index in EUR
Fst_SAS^*	string	genetics	Fixation index in SAS
Fst_EAS^*	string	genetics	Fixation index in EAS
Fst_AMR^*	string	genetics	Fixation index in AMR
Fst_AFR^*	string	genetics	Fixation index in AFR
iHS_EUR^*	string	genetics	Integrate Haplotype score in EUR
iHS_SAS^*	string	genetics	Integrate Haplotype score in SAS
iHS_EAS^*	string	genetics	Integrate Haplotype score in EAS
iHS_AMR^*	string	genetics	Integrate Haplotype score in AMR
iHS_AFR^*	string	genetics	Integrate Haplotype score in AFR
xpnsl_EUR^*	string	genetics	cross-population NSL in EUR
xpnsl_SAS^*	string	genetics	cross-population NSL in SAS
xpnsl_EAS^*	string	genetics	cross-population NSL in EAS
xpnsl_AMR^*	string	genetics	cross-population NSL in AMR
xpnsl_AFR^*	string	genetics	cross-population NSL in AFR
ClinVarID^*	string	clinvar	the ClinVar Allele ID
CLNDN^*	string	clinvar	ClinVar’s preferred disease name for the concept specified by disease identifiers in CLNDISDB
CLNDISDB^*	string	clinvar	Tag-value pairs of disease database name and identifier
CLNREVSTAT^*	string	clinvar	ClinVar review status for the Variation ID
CLNSIG^*	string	clinvar	Clinical significance for this single variant
CLNSIGCONF^*	string	clinvar	Conflicting clinical significance for this single variant
CLNVC^*	string	clinvar	Variant type
CLNVCSO^*	string	clinvar	Sequence Ontology id for variant type
CLNVI^*	string	clinvar	the variant’s clinical sources reported as tag-value pairs of database and variant identifier
GENEINFO^*	string	clinvar	Gene(s) for the variant reported as gene symbol:gene id
MC^*	string	clinvar	comma separated list of molecular consequence in the form of Sequence Ontology ID\|molecular_consequence
ORIGIN^*	string	clinvar	Allele origin

JsonArray Parameters

	Type	JsonArray	Description
geneID	string	data_gene	RefSeq Gene ID
geneName	string	data_gene	Official gene symbol
geneRelativePosition	string	data_gene	Relative position of the closest gene to the query
geneDescription	string	data_gene	Gene description
chromhmmCell	string	data_chromhmm	Cell type of the corresponding chromatin state
chromhmmName	string	data_chromhmm	Short name of chromatin state
chromhmmFullName	string	data_chromhmm	Full name of chromatin state
chromhmmCellDescription	string	data_chromhmm	Cell type description
chromhmmTissue	string	data_chromhmm	Tissue of the cell type
motif	string	data_motif	Motif ID in TRANSFAC or JASPAR
motifStrand	string	data_motif	Strand of the motif
motifSource	string	data_motif	Database source of the motif
motifMatchedSequence	string	data_motif	Matched sequence for the motif
motifMatchedSequencePos	string	data_motif	Relative position of the query to the sequence
motifRef	string	data_motif	Reference allele
motifAlt	string	data_motif	Alternative allel
tfbsCell	string	data_tfbs	Cell type of the corresponding TFBS
tfbsFactor	string	data_tfbs	Name of the transcription factor
tfbsCellTissue	string	data_tfbs	Tissue of the cell type
tfbsDNAAccessibility	string	data_tfbs	DNA accessibility of the TFBS
tfbsCellDescription	string	data_tfbs	Description for the cell type
eqtlGene	string	data_eqtl	Related gene of the eQTL
eqtlPValue	string	data_eqtl	P-value of the eQTL
eqtlTissue	string	data_eqtl	Tissue in which the eQTL identified
eqtlEffect	string	data_eqtl	Effect size of the eQTL
loopGene	string	data_loop_gene	Genes interacting the query SNP through chromatin loops
loopGeneID	string	data_loop_gene	RefSeq Gene ID
loopGeneDescription	string	data_loop_gene	Gene description
loopCell	string	data_loop_gene/data_loop_snp	Cell type in which the chromatin loop was identified
loopCellTissue	string	data_loop_gene/data_loop_snp	Tissue of the cell type
loopCellDescription	string	data_loop_gene/data_loop_snp	Cell type description
loopStart	string	data_loop_gene/data_loop_snp	Start genomic position of the chromatin loop
loopEnd	string	data_loop_gene/data_loop_snp	End genomic position of the chromatin loop
loopType	string	data_loop_gene/data_loop_snp	Type of the chromatin loop: “Within Loop” or “Anchor-to-Anchor”
loopSNP	string	data_loop_snp	SNPs interacting with the query and in the same LD block through chromatin loops
loopLD	string	data_loop_snp	r^2 in LD
loopPopulation	string	data_loop_snp	Continental population (AFR, AMR, ASN, EUR and SAS)

Request with position

URL example1 : single position and single data type in json format

Request URL :

https://www.omic.tech/3dsnpv2/api.do?position=1000000-1100000&chrom=chr11&format=json&type=basic

Response format :

[
    {
        "id":"chr11-1009478-INS-50",
        "position":"1009477",
        "chrom":"chr11",
        "AFR":"0",
        "AMR":"0",
        "Alt":"AACACGCAGCCCATGACCCCGCGCCAGGGTCTGGAGGGACGGCCCCGGGGG",
        "EAS":"0",
        "EUR":"0",
        "Ref":"A",
        "SAS":"0",
        "MAF":"INS,0.000000",
        "linearClosestGene":""
    },
    {
        "id":"rs544411125",
        "position":"1000017",
        "chrom":"chr11",
        "AFR":"0",
        "AMR":"0",
        "Alt":"A",
        "EAS":"0",
        "EUR":"0",
        "Ref":"G",
        "SAS":"0.001",
        "MAF":"A,0.000199681",
        "linearClosestGene":"AP2A2,161,intron-variant",
        "data_gene":[
            {
            "geneID":"161",
            "geneName":"AP2A2",
            "geneRelativePosition":"intron-variant",
            "geneDescription":"adaptor related protein complex 2 alpha 2 subunit"
            }]
        }
]

URL example2 : single position and mutilple data types in xml format